Junk DNA …Trashed Again,

by Elysse Baumbach, 5/28/16

Repetitious “words” in DNA represent more than half of the human genome’s three billion nucleotides.¹Because human reasoning essentially views the repetition of words in spoken languages as errors, these DNA sequences were first written off as meaningless junk. Secular scientists assumed that natural processes somehow produced the repeats over eons of evolution through accidental duplications and that these accidents were carried along in the genome as useless baggage. Now it appears nothing could be further from the truth since these repetitive words are linked with pervasive biochemical function.¹

One class of repetitious human genome sequences recently highlighted in the news is called tandem repeats (TRs). These are simply stretches of DNA comprised of two or more contiguous copies of a “word” (called amotif) arranged in a head-to-tail pattern. For example, the TR “ttacttacttacttacgttac” is simply a repeat of the four-base motif “ttac” five times. Amazingly, these TRs are found all over the human genome: inside genes, outside genes, and even inside the protein-coding regions of genes. Among individual humans, many TRs vary in the length of the repeat. They have been used in forensics as highly effective DNA markers to solve criminal and paternity cases.

Despite knowing about these TR sequences and using them as reliable genetic markers, scientists have known very little about their actual function. Historically, anomalies like these repeating sequences, that seem to make little sense upon first glance, were often relegated to the trash bin of “junk DNA.”

However, one group of researchers recently took a different approach and hypothesized that these sequences may have a purpose. They developed a set of experiments to test the effect of TRs on gene expression and the epigenetic modification of DNA. Epigenetic modification is the addition of molecular tags to the DNA molecule without changing the actual DNA sequence. The result is altered gene expression.

http://creationrevolution.com/junk-dna-trashed-again/